Chrześcijanie biblijni. Fan czy naśladowca Jezusa.

Chrześcijanie biblijni. Prawda dla NAŚLADOWCÓW JEZUSA CHRYSTUSA "Poznacie prawdę, a prawda was wyzwoli"

Relacja z konferencji uwalniania od demonów w Krotoszynie.

Miałem to opisać  jutro, ale chęć podzielenia się moimi przeżyciami była silniejsza 🙂

Do Krotoszyna udałem się w kilku celach:

 

  1. Poddać się testowi podczas uwalniania od demonów.
  2. Dokonania audytu 🙂 zboru Charisma.
  3. Doedukowania się kwestii zagrożeń duchowych.

 

 

Pismo naucza „Wszystko badajcie, a co szlachetne – zachowujcie! 22 Unikajcie wszystkiego, co ma choćby pozór zła.”.  1 Tesaloniczan

Zbadałem jak Pismo mówi. Nauczania były podzielone na cztery sesje, które naprzemiennie prowadzili pastor Janusz Lindner z pastorem Darkiem Spławskim.

Wszystko w mojej ocenie było stricte biblijne, choć zapewne „posprzeczałbym” się z p. Lindnerem nt szabatu i wieprzowiny, ale przecież i tutaj na tym blogu są na te tematy spory. Obaj prowadzący są osobami charyzmatycznymi w sensie osobowości, ale nie w sensie liderów sukcesu.

Pastor Spławski podkreślił rolę jedności kościoła Jezusa, ale nie tej ekumenicznej, a skupionej na walce nie z ciałem i krwią, ale ze zwierzchnościami. Zaskoczył mnie ów pastor kiedy podał przykład nienawiści na znanej nam osobie. Nie wiedziałem, że odbije się to takim echem. Powiedział on, że powstało wiele różnych stron mających np w nazwie „pan Jezus jedyna prawda” itp, gdzie sieje się nienawiść i burzy jedność chrześcijan, nie widział nigdy brata którego oczernia a pisze o nim. Takie postawy skutkują odejściem ludzi od takich autorów stron…. Jak widać autor owej strony stał się popularny w środowisku pastorów…

Mamy jednoczyć się w walce z demonami, a nie z ludźmi. W sumie taka jest podstawa biblijna z listu Pawła do Efezjan.

Janusz Lindner z kolei uświadomił mi coś, na co zwrócił mi uwagę brat Bodzio – wagę Chwały Boga. Istotnie, jest to potężna broń, o czym przekonałem się podczas sesji uwalniania, a czego nie doceniałem.

 

Część praktyczna bardzo wiele zmieniła w moim postrzeganiu świata chrześcijan i Boga. Modlitwa o uwolnienie dotyczyła: łamania przekleństw pokoleniowych i niebożych przekonań, leczenia zranień duszy, uwalniania z ucisków demonicznych oraz  uzdrowienia z chorób.

Z początku nic się nie działo, ale już przy łamaniu przekleństw pokoleniowych były dwie manifestacje demoniczne objawiające się krzykami oraz rzucaniem ciałem tych osób. Kiedy to widziałem, chciało mi się płakać. Oczy zaczęły mi łzawic i tak aż do końca. Wynikało to ze stałego gromienia w imię Jezusa. Nie Jahwe, nie Ducha Świętego, ale w imię Jezusa. Zobaczyłem faktyczną moc imienia Jezus. Zobaczyłem potęgę Boga naszego kochanego. Zobaczyłem również jak wiele osób jest poranionych i jakie jest to wszystko realne. Było mi szkoda tych ludzi.

Dotychczas przeczytałem prawie wszystkie możliwe książki na rynku polskim dotyczące uwalniania, ale praktyka to zupełnie coś innego.

Zapomniałem dodać, że przed uwalnianiem wielbiliśmy Jezusa. Co mnie mile zaskoczyło, jeden song był w rytm muzyki cygańskiej :-).

W miarę upływu czasu i wymawiania przez pastora nie pamiętam nazwiska, różnych grzechów, zniewoleń coraz więcej osób zaczęło krzyczeć, wić się, dostawać ataku.

Większość osób zdemonizowanych stanowiły kobiety. Demony ujawniły się w nich głównie przy wyrzucaniu ducha buntu, poronienia, bękarta itp. Nie wiem czy dobrze zauważyłem, ale u jednego mężczyzny zamanifestował się duch przy wyrzucaniu ducha hazardu.

Teraz najważniejsze. Byłbym nawet i wtedy bardzo sceptyczny (sam nie miałem manifestacji) )gdyby nie fakt zamanifestowania się demonów w bracie, który jest czytelnikiem tego bloga, a którego problemy mniej więcej znałem, choćby z atakowania mnie kilka razy, co mu już dawno wybaczyłem. Właśnie, podstawą uwalania jest wybaczenie innym i  taka deklaracja, którą to wszyscy publicznie wypowiedzieli wymieniając osoby, którym wybaczają. Sam takiej dokonałem.

Brak wybaczenia jest furtką dla demonów. Brat, którego spotkałem na początku zaczął kasłać. Pomyślałem, że może sobie coś wmawiać. Jednak za chwilę podszedł do niego jakiś pastor, a następnie wziął na bok. Demon objawił się adekwatnie do głównych grzechów, o których nie będę pisał, ale jest to bardzo znany i masowy obecnie grzech. Po około 10 minutach uwalniania brata/czytelnika bloga z niedowierzaniem słyszałem już nie kasłania, nie jęczenia, ale potężne ryki niczym z horroru. Patrzyłem na to i prawie płakałem. Do brata w wierze dołączyły jeszcze bodajże cztery osoby modlące się o niego. Wstałem i ja i ze łzami w oczach prosiłem też o uwolnienie go,  licząc się z tym, że moja praca modlitewna  to ziarenko piasku na plaży, a w powietrzu odbywa się wielka bitwa o brata.

Jak mnie poinformował, wyszło aż 11 demonów.

Są to sprawy na prawdę bardzo bardzo realne.

Podczas całej konferencji dominowało imię Jezus, a pastor sam powiedział, iż wyganianie demonów to sprawa drugorzędna, bo i tak na pierwszym miejscu powinien być Jezus..

Chwała Bogu w imię Jezusa za ten zbór i ich pracę. Zapewne pomogli już setkom osób uwalniając ich od koszmarów wynikających ze zniewolenia i traum itp.

Do tej pory jestem poruszony tym wszystkim.

Pastor Lindner to bardzo dobrze zorganizowany człowiek, dobrze zarządzający zborem z charakterem dowódcy.

 

ps. Chwała Bogu siostrze naszej w wierze, która pchnęła naszego brata do Krotoszyna. To jest właśnie jedność.

Jestem pewien, że z co najmniej kilku osób z którymi miałem problemy na blogu demony wyszłyby również.

 

Jeśli ktoś potraktuje takie spotkanie jak li tylko ciekawe doświadczenie bez wyciągnięcia wniosków jak należy żyć, to będzie to tylko i jedynie niczym obejrzenie interesującego filmu.

Mną wstrząsnął ten dzień.

 

Updated: 21 maja 2017 — 12:01

54 komentarze

Add a Comment
  1. Chwała Bogu! 🙂
    Miałam się tam wybrać, ale zwątpiłam (czytałam nieprzychylne opinie) i ostatecznie nie pojechałam. Jak widać wszystko jednak jest w porządku i być może następnym razem pojadę :).
    Teoria teorią, ale widzieć na własne oczy potęgę Ojca i moc imienia Jezus na taką skalę na pewno wiele zmienia w postrzeganiu świata i walki duchowej. Oczywiście na plus 🙂

    1. Jedna kobieta jakby z chorobą neurologiczną będąca z matką miała manifestacje przy przekleństwie pokoleniowym.
      To mi uświadomiło jak grzechy (bezprawie) są niszczące nie tylko nas samych, ale nasze dzieci…

      1. Stąd choroby „genetyczne”, których źródła nauka nie jest w stanie znaleźć. Podobnie rzecz ma się z uzależnieniami czy chorobami/zaburzeniami psychicznymi, które rzekomo przechodzą w genach. Często przyczyna jest właśnie duchowa i jest wynikiem przekleństwa, grzechów naszych rodziców, dziadków itd. Na nieszczęście nauka niemal całkowicie wyparła duchowość, dlatego czasem nawet wieloletnie terapie nie przynoszą żadnych skutków i ludzie nadal cierpią. A wystarczyłoby przyjść do Jezusa…

        1. Moim zdaniem, kod DNA to prawdopodobnie zwiedzenie, czy wierzycie, że z Waszej śliny można odtworzyć całych Was?

          Wpiszcie sobie w google grafika frazę:
          dna under electron micorscope

          Jeśli wierzyć fotografiom…, jak z nich można wydedukować gdzie jest A C G T, czyli poszczególne białka kodu DNA?

          Zagadka dla osób znających informatykę, mając np. króciuteńki kod DNA:
          ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC
          CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC
          CTCCTGACTTTCCTCGCTTGGTGG
          jak rozpoznać gdzie jest zmienna, gdzie funkcja, gdzie klasa, gdzie metoda, gdzie rekurencja, gdzie odwołanie, gdzie skok do pamięci itp. Mając sam kod binarny czyli 0 i 1, jest to trudne do ustalenia a co dopiero w przypadku kodu 4 bitowego.

          Programiści gubią się we własnym kodzie, który jest pisany językiem programowania czyli w miarę zrozumiałym dla człowieka, przekształcenie tego kodu do postaci binarnej czyni go kompletnie nieczytelnym nawet dla tego co go pisał.

          Owszem istnieje coś takiego jak inżynieria odwrotna (dekompilatory, deasemblery), ale ona jest możliwa tylko dlatego, że zna się języki programowania, które mogły zostać użyte do napisania danego programu, bez znajomości tych języków nie wiem czy komuś udałoby się rozszyfrować dany kod. Dobrze byłoby gdyby na ten temat wypowiedział się ktoś kto zna zagadnienie inżynierii odwrotnej.

          Być może jesteśmy zbudowani z kodu, tak jak np. SIMSy są zbudowane z kodu, ale czy w ślinie SIMSa jest zapisany kod całego SIMSa?

          1. mam jedną prośbę nie zamieniajmy tego bloga w forum Pana Kubika…jak nie wierzysz, że DNA isnieje to kup sobie mikroskop elektronowy (albo skorzystaj z niego w jakimś laboratorium). kod dna jest trójkowy, występują w nim sekwencje kodujące i niekodujące, a „dekompliatory” to specjalne enzymy rozszyfrowujące i kopiujące sekwencje nukleotydów. głównym powodem ataków na chrześcijan jest to, że nie posługują się naukowymi metodami i ogólnie z nauką są na bakier. ostatecznie Biblia nie jest jedynym źródłem wiedzy o świecie…a prawdziwy chrześcijanin powinien weryfikować informacje bardziej niż przeciętny laik i nie opierać się na domysłach (co jest nagminne u wielu trutherów)

            1. Racja, DNA to kod 3 bitowy, zagalopowałem się.

              Właśnie czytając Biblię, zacząłem krytycznie patrzeć na naukę…

              1. To z całym szacunkiem trochę źle ją czytasz, lub za naukę bierzesz coś, co nią nie jest.

                1. Może masz rację, być może źle czytam Biblię ale weźmy na przykład niniejszy arkykuł o wypędzaniu demonów, praktycznie każdy świecki naukowiec Was wyśmieje i wyśle do psychiatryka, zgaduję że pewnie niedługo zostanie to prawnie ustanowione.

                  Weźmy inny przykład, o Samsonie i jego długich włosach dających mu siłę, czy to jest w jakiś sposób naukowe, mnie to wygląda raczej na kod programu (instrukcja if, „bo ja tak powiedziałem”), nie mam tutaj na myśli kodu DNA ale kod nadrzędny, do którego nie mamy dostępu z tego świata (moje przypuszczenia). Tak jak w grach komputerowych, znajdziesz jakiś szczególny diamencik i już masz więcej siły :), nie ma żadnego logicznego wytłumaczenia tego zjawiska, a jak zapytasz programistę – dlaczego, odpowie, „bo ja tak napisałem” :). Przepraszam, że to tak głupio brzmi ale taka analogia przychodzi mi na myśl czytając Biblię, jednakże chętnie posłucham wytłumaczenia w jaki sposób ścięcie włosów zmieniło DNA Samsona, jego siła nie wynikała z treningu więc coś musiało się zmienić, jeśli nic się nie zmieniło no to gdzie tutaj jakaś nauka?

                2. Siła pochodziła od Samsona? Czy od Boga?
                  Tak, jak opętana przez demona maleńka kobieta może mieć ogromną siłę, że kilku mężczyzn nie jest jej w stanie utrzymać.
                  Przecież Bóg może wszystko, co za problem wpłynąć na materię?
                  Nawet chemiczne lekarstwa, narkotyki, środki anestezjologiczne potrafią w tak wielkim stopniu wpłynąć na organizm człowieka. A różne mutacje? Przecież byle czynnik może je spowodować.

      2. Miałam kiedyś taki sen -ktoś wskazał na mnie trzecie pokolenie .Trzeba poznać Prawdę o naszych przodkach .Prawda Was wyzwoli ,lecz nie każdy jest w stanie ją odkryć .Ciekawie piszesz Piotrze .Kiedyś opowiem Wam swoje doświadczenie .Trzymajcie się .Z Bogiem.

  2. Chwała Panu Jezusowi!
    Dzięki za prące wszystkich dzieci Bożych nad poszerzaniem Królestwa Bożego.
    Dzięki wielkie za podzielenie się z nami relacją z konferencji.Aż się popłakałam ze wzruszenia, dzięki Bogu!
    Chwała Bogu za pastorów z Krotoszyna!

    1. na prawdę po tej konferencji widzę jaką pracę diabła wykonują ci, co kłócą się stale na wersety.
      Walczmy duchowo, a nie z ludźmi.

  3. Komu zaś wy coś przebaczacie, temu i ja; gdyż i ja, jeżeli w ogóle miałem coś do przebaczenia, przebaczyłem ze względu na was w obliczu Chrystusa, (11) aby nas szatan nie podszedł; jego zamysły bowiem są nam dobrze znane 2kOR.10-11
    Moc szatana jaka przeciwnika jest bardzo różnorodna, „A zaraz potem wszedł w niego szatan. Rzekł więc do niego Jezus: Czyń zaraz, co masz czynić” (Jan. 13:27). „I rzekł Piotr: Ananiaszu, czym to omotał szatan serce twoje, że okłamałeś Ducha Świętego i zachowałeś dla siebie część pieniędzy za rolę?” (Dz. Ap. 5:3). „Aby otworzyć ich oczy, odwrócić od ciemności do światłości i od władzy szatana do Boga, aby dostąpili odpuszczenia grzechów i przez wiarę we mnie współudziału z uświęconymi” (Dz. Ap. 26:18).
    „Oddajcie takiego szatanowi na zatracenie ciała, aby duch był zbawiony w dzień Pański” (1 Kor. 5:5).
    „Nie strońcie od współżycia z sobą, chyba za wspólną zgodą do pewnego czasu, aby oddać się modlitwie, a potem znowu podejmujcie współżycie, aby was szatan nie kusił z powodu niepowściągliwości waszej” (1 Kor. 7:5).
    „Bym się więc z nadzwyczajności objawień zbytnio nie wynosił, wbity został cierń w ciało moje, jakby posłaniec szatana, by mnie policzkował, abym się zbytnio nie wynosił” (2 Kor. 12:7).
    „Dlatego chcieliśmy przyjść do was, ja, Paweł, i raz i drugi, ale przeszkodził nam szatan” (1 Tes. 2:18).
    „Do nich należą Himeneusz i Aleksander, których oddałem szatanowi, aby zostali pouczeni, że nie wolno bluźnić” (1 Tym. 1:20).
    „Albowiem niektóre już się odwróciły i za szatanem poszły” (1 Tym. 5:15).

    Jak widzimy wszystkie grzechy,nie tylko pokoleniowe są w zasadzie furtką do wejścia demonów lub samego szatana w ciało człowieka i manipulowanie nim jak robotem do własnych celów.
    1. Złodziejstwo ,pycha ,chciwość,zazdrość ,nieprzebaczenie ,wszeteczeństwo ,pijaństwo ,bluźniertwo ,itp.

    1. Dziękuję za te wersety Jacku 🙂

  4. Bardzo to ważne dla mnie co tutaj umieściłeś, dziękuje i niech Pan Ci Błogosławi

  5. Chwała Bogu za tych wszystkich ludzi i ich pracę dla Królestwa Bożego.
    Dziękuję Ci Piotrze, za to że pojechałeś i sprawdziłeś ten zbór. Dzięki temu wielu dowie się, że i w Polsce są ludzie zajmujący się kwestią uwolnienia w zgodzie z Biblią.
    Zadziwiające, a może i nie aż tak bardzo, jest to, że ostatnio rozmawiałam z Bogiem na temat uwolnienia. Potem na facebooku na mojej tablicy pojawia się link do fanpage tego zboru, pewna siostra w wierze też tam jeździła, a teraz Piotr wstawia refleksje z pobytu tam… Więc zapewne muszę tam się wybrać.

    Kompletnie nie miałam pojęcia, że i w naszym kraju wśród kultu gaii i królowych niebios, mamy zbór i ludzi, którzy pomagają w tym zakresie.

    1. Byli także o wyrzekaniu się kultu Marii

      1. Mam pytanie a jak było wyrzekanie się kultu Maryjnego to czy demony w widoczny sposób wychodziły z ludzi?

    2. Ja też nie wiedziałam, że istnieją tacy ludzie…dziękuję bardzo za informację…

  6. Bardzo budująca relacja. Chwała i dzięki Bogu za posługę uwolnienia, i za to że Bóg przez swoich ludzi i swoje Słowo przysposabia nas do duchowej walki i życia w jedności Chrystusa.

    1. *miało być w jedności Ducha Świętego

  7. Artur S. (detmold)

    Duzo ludzi boi sie tego tematu, gdyz tak silnie sa kontrolowalni-zniewolenie przez zle byty duchowe. W zabetonowonej przez bluznierstwo watykanskie Polsce widac to szczegolnie ( rodzime przywary spowodowane przez oddawanie sie katolickiemu nierzadowi duchowemu )…

    1. Możesz z łatwością znaleźć kilka filmów na YT, gdzie złe duchy są „wyganiane” z wierzących, podczas katolickich mszy, zebrań. Jeden czy dwa niedawno wstawione(w wakacje oglądałem), pokazują polskiego księdza, który przyjechał z zagranicy i egzorcyzmował Polskę, wyganianie duchów z ludzi wyglądało jak u Cerońskiego i pewnie w KZ Charisma, chociaż nie widziałem, to ze słów pastora się domyślam. I te katolickie filmy, kiedy je oglądałem miały kilkadziesiąt tys. odtworzeń. Jakieś inne kazanie tego księdza – kilkaset tysięcy odtworzeń. Przecież zły duch musiałby wygnać Ducha Świętego z wierzącego, co jest niemożliwe. Pastor Janusz Lindner twierdzi, że wierzący może mieć demona i porównał to do jedzenia potraw ofiarowanych bożkom.

  8. Właśnie oglądam https://www.youtube.com/watch?v=4M0Q9HnbvT0 Ten człowiek ma takie same poglądy jak Ceroński, obejrzałem naprawdę wiele filmów Cerońskiego.

    1. Wyjaśnianie demonów nie świadczy o świętości człowieka wyganiajacego tak samo jak mowa językami.
      Może ktoś wyganiać demony i być złym człowiekiem co powiedział sam Jezus.

      W owym dniu wielu mi powie: Panie, Panie, czyż nie prorokowaliśmy w imieniu twoim i w imieniu twoim nie wypędzaliśmy demonów, i w imieniu twoim nie czyniliśmy wielu cudów?

      Chciałem tym wpisem pokazać że uwalnianie jest realne i aktualne.
      Ludziom to pomaga,
      Jednak owszem może byc tak, że ktoś to robi skutecznie a np nie trzyma się biblijnych nauk. To jak no Stokłosa pomaga ludziom ale jest jaki jest…..
      Skutek finalny w przypadku tej konferencji : uwolnienie ludzi i Chwała Jezusa.

      Nie znam osobiście pastora Lindnera a opisałem to co widziałem.
      Jak masz coś Kamilu przeciw niemu to możesz napisać merytorycznie co na podstawie bibli mu zarzucasz.

      1. Artur S. (detmold)

        Wapliwej ( relatywnej ) moralnie natury. Zli to pacholki diabla.

  9. Bracie jeśli będzie następna taka konferencja to napisz proszę, bo chciałabym się wybrać.

  10. Piotr Admin pisze, cytuję:

    „Zapomniałem dodać, że przed uwalnianiem wielbiliśmy Jezusa. Co mnie mile zaskoczyło, jeden song był w rytm muzyki cygańskiej :-).”

    no i jak, czy w Krotoszynie, na konferencji,
    uwolniono jakiegoś demona od niejakiego selera ???
    🙂 🙂 🙂

    pozdrawiam 🙂

  11. Czemu ja nic o takich wydarzeniach nie wiem.. A czy ktoś się orientuje czy za granicą też takie wydarzenia maja miejsce?

    1. Marta a gdzie dokładnie?

  12. Polecam rowniez KZ Charisma !!

  13. Super ! też polecam ten zbór – oglądałem bardzo dużo kazań Janusza Lindera i są jak najbardziej ok ! drzewo poznaje się po owocach, a widać, że oni mają same dobre owoce – uwalniają ludzi/uzdrawiają, a o to właśnie chodzi ! wielu ludzi otrzymało pomoc…

    1. i chwała Bogu, Maciej !
      jeżeli są owoce wewnętrznej wspólnoty u tych ludzi
      to i na zewnątrz też będą, by pomóc, Hej !

      Bóg działa bezpośrednio i poprzez wiernych Mu istot, …mogą to być nawet zwierzęta, a co ?

      Ciganski diabli – Montiho cardas
      .https://www.youtube.com/watch?v=8fot7ORv6ig

  14. Artur S. (detmold)

    Czy admin Piotr moglby skomentowac biblijnie sprawe tego 25 lata chlopaka zabitego na komisariacie policji ( zaszczutego pradem w klozecie-ubikacji )? Paskudnie to wyglada…

    1. Arturze,
      biblijnie to wygląda tak:

      NIE MORDUJ [nie zabijaj]

      czy Admin Piotr ma iść i rozwalić ten cały komi_SZARIAT ?

      tak przypuszczam, że Admin jeżele nie skomentuje,
      to jak znajdzie chwilkę czasu, to rozwali… 🙂

      seler

    2. kurcze… zapomniałem krzyknąć

      HEJ ! – 🙂

  15. a mi wybaczyłeś?

    1. Wybaczylem Ci w momencie kiedy mi ublizales pomimo braku przepraszam, ale to nie oznacza ze będę tolerował takie zachowanie na blogu. Jakieś reguły być muszą. Nie ma mowy o anarchii a Twoje wpisy mogą gorszyc innych. Zresztą sam pisałeś żegnam.

  16. Co się dzieje z demonami po wyjściu z człowieka?
    wędruje i szuka sposobu aby wejść spowrotem w tego samego człowieka ze swoimi kolegami! ,jeśli wcześniej ów człowiek nie przygotuje jemu wymiecionego mieszkania ,futkę -otwarte drzwi ,czyli życie w ciągłym grzechu.
    Uwolnienia tylko tymczasowo są przydatne dla ludzi ,tak samo jak chleb rozdawany bezdomnym czy ubogim, ,lecz w dalszym ciągu ci ludzie są na szerokiej drodze! ,a pozatym jestem zaaaaaa takimi akcjami ,może ludzie choćby kilku osób gdy zobaczą fizyczną nadprzyrodzoną potężną moc Pana ,zaczną Go szukać?

    Gdy zaś duch nieczysty wyjdzie z człowieka, wędruje po miejscach bezwodnych, szukając ukojenia, ale go nie znajduje. Wtedy mówi: Wrócę do domu swego, skąd wyszedłem, i przyszedłszy, zastaje go opróżnionym, wymiecionym i przyozdobionym. Wówczas idzie i zabiera z sobą siedem duchów innych gorszych niż on, i wszedłszy mieszkają tam; i bywa końcowy stan człowieka tego gorszy niż pierwotny. Mat.12:43-45

    1. Dlatego ów brat miał jeszcze chrzest DS.

  17. jeszcze o szczepionkach napiszę,
    pewno nie w temacie
    ale konferencję
    zrobię

    uwolnienia od toksyn i bakterii,
    pijmy sok z marchwi, selera
    i jabłek… i nikt WAS
    nie ruszy
    🙂

    demony czerpią szie naszym zdruzgotaniem
    bo kochają śmierć i unicestwienie
    jak królowa niebios i papież
    i powiedzmy w końcu takim
    NIE. po stokroć NIE !

    seler

    1. Karol Szulawiak

      „uwolnienia od toksyn i bakterii,
      pijmy sok z marchwi, selera
      i jabłek… i nikt WAS
      nie ruszy”

      A czy można pić..z selerem? Bo tak samemu to nudno 😀

      1. Karol Szulawiak

        Seler nie dał songa..
        To ja zapodam sonki..znaczy sanki 😀

        https://youtu.be/00FXZ-qWuSI

        By Michał Mazur.
        HalleluYah, chwalmy Króla 😉

  18. znacie Kubusia Puchatka ?
    szie przyjaźnił z Prosiaczkiem
    razem byli kiedyś we wojsku

    i nagle Prosiaczek zaginął w akcji

    Puchatek poszedł odszukać i wchodzi
    do sklepu mięsnego i widzi
    i wyciąga karabin i strzela !!!
    taataaa, tatatata, tata !

    szie żywe ekspedientki pytają: – ZA CO ?

    …to za Prosiaczka,
    odpowiedział Puchatek…
    __________

    piosenka dla Puchatka

    Đorđe Balašević – Devojka sa čardaš nogama |Live|

  19. Wybaczenie drugiej osobie jest jedną z najważniejszych spraw, jakie powinniśmy zrobić względem drugiego człowieka.

    Brak wybaczenia zamyka dostęp do wolności, nasyca gorycz i inne złe emocje w sercu i człowieku.

    Ludzie czasem z powodu urazy nie chcą wybaczyć. Duszą to w sobie i żyją z tym.
    Blokują się tym na Boże wybaczenie.
    Jeśli nie wybaczysz innym ludziom, Bóg ci nie wybaczy.

  20. Żywię nadzieję, że pastor uwalniający podkreślił dokładnie, że teraz potrzebna jest przemiana serca, prawdziwa i szczera relacja z Chrystusem.
    Inaczej stan tych osób będzie gorszy niż wcześniej, bo demony wracają z silniejszymi i jesli znajdą uprzątnięte wnętrze to jeszcze bardziej będą chciały ta zamieszkać.

  21. Oglądałem wykłady zboru w Krotoszynie dostępne na YouTube, wiele mi pomogły i rozjaśniły co do walki duchowej, zmiany myślenia.

    Polecam każdemu obejrzeć wykłady i wyciągnąć wnioski z wykładów, spojrzeć na swoje życie i zastosować zmiany w nim.

    Chwała Bogu 🙂

  22. Czy zna ktoś może Daniela Chanda? Wkrótce ma przyjechać do Polski i ma być w 5 miastach. Podobnie ewangelizuje jak Torben Søndergaard
    Piotrze adminie mam pytanko czy w Krotoszynie posługują tak samo jak wyżej wymienione osoby?
    Dla mnie chyba jeszcze za wcześnie, (pije jeszcze mleko) jakos nie moge sie przekonać narazie poobserwuje i będe sie przyglądał i starszych w Panu słuchał, aby nie zbłądzic i oczywiscie naszego Pana Jezusa o wszystko pytał;-)

    1. Karol Szulawiak

      Od 1:44 widać różne padaczki i drgawki i padania na plecy
      Więcej mi nie trzeba.
      Jeśli jeszcze pijesz mleko, to póki co, uciekaj od tego jak najdalej.
      Tutaj więcej o tej herezji, i ogólnie dużo o tym znajdziesz na tym kanale.

      1. „Pij mleko* będziesz wielki” 🙂

        *zastosowanie tylko do Słowa Bożego 🙂

  23. Dziękuje za odpowiedzi i pomoc. Niech wam Bóg Błogosławi i was strzeże 🙂 muszę przejść na przyjmowanie stałego pokarmu, mleko jest dla niemowląt, a ze mnie stary byk.
    Dobrze że już smoczek odstawiony 😀

    1. Karol Szulawiak

      Oczywiście należy pamiętać, że ludzie też stopniowo przerzucają się na pokarm stały, bo nawet jak berbeć dostanie stały pokarm, to rodzic musi mu pomóc się posilić 😉
      Ale żeby nie było że tylko napominam i ostrzegam, to coś na zachętę 😉

      https://youtu.be/O646vQOjIFo?list=PLNrhqI2nW3Clmq8TbtghXvB_lnilxa8Gd

      1. Karol Szulawiak

        ehh..a przecież odznaczyłem „udostępnij na playliście”

        https://youtu.be/O646vQOjIFo

        to powinno być.

        Przepraszam za zamieszanie 😉

  24. Haha dobrze że udało się odstawić smoczka… ale za to teraz będzie większy smok!

    „I rozgniewał się Smok na Niewiastę, i odszedł rozpocząć walkę z resztą jej potomstwa, z tymi, co strzegą przykazań Boga i mają świadectwo Jezusa.”

    Jak nic potrzeba stałego pokarmu by dorosnąć do przywdziania zbroi 😉

Dodaj komentarz

Twój adres email nie zostanie opublikowany. Pola, których wypełnienie jest wymagane, są oznaczone symbolem *

Detektyw Prawdy, Dobra Nowina i Apokalipsa © 2015 Frontier Theme
%d bloggers like this: